A Comprehensive Monograph on Viltolarsen (Viltepso): A Targeted Exon-Skipping Therapy for Duchenne Muscular Dystrophy at a Clinical and Regulatory Crossroads

Executive Summary

Viltolarsen, marketed under the brand name Viltepso, is a synthetic antisense phosphorodiamidate morpholino oligonucleotide (PMO) developed as a targeted therapy for Duchenne muscular dystrophy (DMD).[1] Specifically, it is designed to induce the skipping of exon 53 in the dystrophin (

DMD) gene during pre-mRNA splicing.[3] This mechanism of action aims to restore the translational reading frame in patients with specific genetic mutations, enabling the production of a truncated but partially functional dystrophin protein.[4] This therapeutic strategy represents a precision medicine approach for a subpopulation of DMD patients, estimated to be approximately 8% of the total, who carry mutations amenable to this correction.[3]

The regulatory and clinical history of viltolarsen is defined by a significant divergence between its demonstrated biochemical efficacy and its performance in a pivotal clinical trial. Based on compelling Phase 2 data showing a consistent and statistically significant increase in dystrophin protein levels in the skeletal muscle of treated patients—a surrogate endpoint deemed "reasonably likely to predict clinical benefit"—viltolarsen was granted accelerated approval by the U.S. Food and Drug Administration (FDA) in August 2020.[1] This approval was contingent upon the successful completion of a confirmatory trial designed to verify its clinical benefit.

However, in May 2024, the preliminary results of this confirmatory Phase 3 trial, known as RACER53, were announced. The study failed to meet its primary clinical endpoint, showing no statistically significant difference in motor function between the viltolarsen and placebo groups over 48 weeks.[8] This outcome has placed the drug at a critical regulatory and clinical crossroads, creating profound uncertainty regarding its continued market approval in the U.S. and its prospects in other jurisdictions. Viltolarsen was approved in Japan in March 2020 but remains unapproved in Europe.[10] The drug has consistently demonstrated a favorable safety profile, with most adverse events being mild to moderate in severity.[8] This report provides an exhaustive analysis of viltolarsen, detailing its molecular basis, pharmacologic profile, clinical development program, and the complex regulatory landscape it now navigates in the wake of the RACER53 trial results.

The Molecular Basis of Duchenne Muscular Dystrophy and the Rationale for Exon Skipping

The Pathophysiology of Duchenne Muscular Dystrophy (DMD)

Duchenne muscular dystrophy (DMD) is a severe, X-linked recessive neuromuscular disorder that represents the most common form of muscular dystrophy in childhood.[12] The disease is characterized by the progressive and relentless degeneration of muscle tissue, leading to profound weakness. DMD is caused by mutations in the gene that encodes dystrophin, a critical structural protein.[1] Dystrophin is essential for maintaining the integrity of the muscle cell membrane (sarcolemma) during the mechanical stress of contraction and relaxation. In its absence, the sarcolemma becomes fragile and susceptible to damage, leading to an influx of extracellular calcium, leakage of intracellular components like creatinine kinase, and a chronic inflammatory response.[1] Over time, this pathology results in the gradual replacement of functional muscle fibers with non-contractile fibrous and adipose tissue.[1]

Clinically, symptoms typically manifest between the ages of three and five, with progressive muscle weakness leading to loss of ambulation by the early teens.[12] The disease inexorably affects all skeletal muscles, as well as the cardiac and respiratory muscles. This progression ultimately leads to fatal complications, including cardiomyopathy and ventilatory insufficiency, with death typically occurring in the second or third decade of life.[1] The global incidence of DMD is approximately one in every 3,500 to 5,000 live male births.[6]

The Dystrophin Gene (DMD) and Genetic Etiology

The human dystrophin (DMD) gene is the largest known gene in the human genome, spanning 2.4 megabases on the X chromosome and comprising 79 exons.[14] The vast size of the gene makes it particularly susceptible to spontaneous mutations. The most common mutations causing DMD are large deletions of one or more exons, which account for approximately 60-70% of cases, followed by duplications and point mutations.[1]

The severity of the resulting disease is determined by how the mutation affects the translational open reading frame (ORF). In DMD, "out-of-frame" mutations disrupt the triplet codon sequence, leading to the introduction of a premature stop codon during protein synthesis. This results in a truncated, unstable, and non-functional dystrophin protein, or no protein at all.[6] This contrasts with the allelic and less severe disorder, Becker muscular dystrophy (BMD). In BMD, mutations are typically "in-frame," meaning they do not disrupt the reading frame. This allows for the synthesis of an internally shortened but still partially functional dystrophin protein, leading to a much milder and more variable clinical phenotype.[1]

The Therapeutic Principle of Exon Skipping

The molecular distinction between DMD and BMD provides the foundational rationale for the therapeutic strategy of exon skipping. This approach utilizes synthetic, single-stranded nucleic acid analogues known as antisense oligonucleotides (ASOs) to modulate the splicing of the DMD pre-mRNA.[5] An ASO is designed to bind with high specificity to a target sequence on a particular exon, acting as a "molecular mask" that hides the exon from the cell's splicing machinery (the spliceosome).[14] By preventing the recognition of the target exon, the ASO forces the spliceosome to excise it along with the surrounding introns, effectively "skipping" it and joining the preceding exon directly to the subsequent one.[5]

The therapeutic goal is to convert an out-of-frame mutation into an in-frame one. For example, in a patient with a deletion of exons 45-52, the resulting mRNA is out-of-frame because exon 44 cannot properly connect to exon 53. By using an ASO like viltolarsen to induce the skipping of exon 53, the machinery can then join exon 44 to exon 54, which restores the reading frame.[3] This process does not create a full-length, wild-type dystrophin but rather enables the production of a BMD-like, internally truncated protein that retains its essential functional domains.[2] The entire therapeutic premise rests on the hypothesis that pharmacologically inducing the production of a BMD-like protein in a DMD patient will shift the disease course towards the milder BMD phenotype. The failure of the RACER53 trial to demonstrate clear clinical benefit directly challenges this core assumption, raising critical questions about whether the quantity or quality of the induced dystrophin is sufficient to produce a clinically meaningful effect.[8] Viltolarsen specifically targets exon 53, a strategy applicable to an estimated 8% of the DMD patient population with amenable mutations.[3]

Viltolarsen: Molecular Profile and Chemical Characteristics

Classification and Chemical Structure

Viltolarsen is classified as a biotech drug and, more specifically, a synthetic antisense oligonucleotide.[1] It belongs to a chemical class known as phosphorodiamidate morpholino oligomers (PMOs).[2] The PMO chemistry is distinct from naturally occurring nucleic acids and other ASO backbones. In a PMO, the five-membered ribofuranosyl sugar ring found in RNA is replaced by a six-membered morpholino ring.[1] Furthermore, the negatively charged phosphodiester linkages that connect nucleotides in DNA and RNA are replaced with uncharged phosphorodiamidate linkages.[2] This unique backbone modification renders PMOs electrically neutral and highly resistant to degradation by endogenous nucleases, which contributes to their stability in biological systems.[3]

Physicochemical Properties

Viltolarsen is a 21-nucleotide oligomer (21-mer) with a defined sequence designed for its specific therapeutic target.[3]

• Molecular Formula: The molecular formula of viltolarsen is C244​H381​N113​O88​P20​.[6]
• Molecular Weight: The molecular weight is approximately 6924.8 g/mol.[22]
• Nucleotide Sequence: The specific base sequence of the 21-mer is (5' to 3'): CCT CCA GGT TCT GAA GGT GTT C.[4] The systematic chemical name is all-P-ambo- 2',3'-azanediyl-P,2',3'-trideoxy-P-(dimethylamino)-2',3'-seco(CCTCCGGTTCTGAAGGTGTTC).
• Appearance and Storage: Viltolarsen is supplied as a white to off-white solid. For stability, it should be stored at -20 °C under nitrogen and away from moisture.

Key Identifiers

The drug is identified by several unique codes and names used in regulatory, clinical, and research contexts. These identifiers are consolidated in Table 1.

Table 1: Key Identifiers and Chemical Properties of Viltolarsen

Parameter	Value	Source(s)
Drug Name	Viltolarsen
Brand Name	Viltepso
Generic Name	viltolarsen
DrugBank ID	DB15005
CAS Number	2055732-84-6
Type	Biotech
Drug Class	Antisense Oligonucleotide (ASO), PMO
ATC Code	M09AX12
Other Names	NS-065/NCNP-01
Molecular Formula	C244​H381​N113​O88​P20​
Molecular Weight	6924.8 Da
Nucleotide Sequence	(2'-N→5')(CCTCCGGTTCTGAAGGTGTTC)
Chemical Structure	Phosphorodiamidate morpholino oligonucleotide

Mechanism of Action and Pharmacodynamics

Targeted Molecular Interaction

The therapeutic activity of viltolarsen is predicated on its highly specific binding to the pre-mRNA transcript of the human DMD gene. As an antisense oligonucleotide, its nucleotide sequence is complementary to a specific target region within exon 53. This binding occurs through standard Watson-Crick base pairing, forming a drug-RNA duplex that is stable enough to interfere with the normal cellular processes of mRNA maturation. The specificity of this interaction ensures that viltolarsen's effects are largely confined to the intended dystrophin transcript, minimizing the potential for off-target activity.

Induction of Exon 53 Skipping

Once bound to its target on exon 53 of the pre-mRNA, viltolarsen functions as a steric block. It physically obstructs the binding sites for components of the spliceosome, the large ribonucleoprotein complex responsible for excising introns and ligating exons to form mature mRNA. By masking these recognition sites, viltolarsen effectively renders exon 53 "invisible" to the splicing machinery. Consequently, during the splicing process, the spliceosome bypasses the masked exon 53 and joins the flanking exons (e.g., exon 52 to exon 54) directly. This targeted exclusion of exon 53 is the central mechanistic step that allows for the restoration of the translational open reading frame in patients whose mutations are amenable to this specific skip, such as those with deletions of exons 45-52 or 48-52.

Pharmacodynamic Effect: Dystrophin Protein Restoration

The primary and intended pharmacodynamic effect of viltolarsen is the de novo production of a modified dystrophin protein. The restored reading frame of the mature mRNA allows the ribosome to proceed with translation, synthesizing an internally truncated but partially functional dystrophin protein. This newly produced protein was the key surrogate endpoint measured in the pivotal clinical trials that led to viltolarsen's accelerated approval.

In the Phase 2 study, treatment with viltolarsen at the recommended dose of 80 mg/kg weekly resulted in a substantial increase in dystrophin protein levels as measured by validated Western blot analysis. On average, dystrophin levels rose from a baseline of 0.6% of normal to 5.9% of normal after 25 weeks of treatment. This increase was observed in 100% of the patients who received the drug, providing robust evidence that viltolarsen successfully engages its target and produces the intended biochemical effect. The FDA concluded that this increase in dystrophin was "reasonably likely to predict clinical benefit". However, it is critical to recognize that this 5.9% figure represents a mean value, with considerable inter-patient variability reported, ranging from approximately 1% to 10% of normal levels. This wide range of molecular response may be a key factor in explaining the subsequent failure of the larger RACER53 trial to demonstrate a uniform clinical benefit. It is plausible that while patients achieving higher levels of dystrophin production experienced a clinical benefit, their positive outcomes were diluted by those of lower responders, leading to a non-significant result when the entire cohort was analyzed together.

Comprehensive Pharmacokinetic Profile (ADME)

Administration and Absorption

Viltolarsen is formulated for intravenous (IV) administration. The standard protocol involves a 60-minute infusion, delivered either through a peripheral or central venous catheter. As the drug is delivered directly into the systemic circulation, absorption is considered to be immediate and 100% bioavailable. Pharmacokinetic studies have shown that the peak plasma concentration (

Cmax​) is reached at the end of the 60-minute infusion, with a median time to maximum concentration (Tmax​) of approximately one hour.

Distribution

Following intravenous administration, viltolarsen distributes from the plasma into various tissues.

• Volume of Distribution (Vd​): The steady-state volume of distribution at the recommended 80 mg/kg dose is reported to be 300 mL/kg, indicating that the drug distributes beyond the plasma volume but is not extensively sequestered in peripheral tissues.
• Plasma Protein Binding: A key characteristic of the PMO chemical class is its low affinity for plasma proteins. Viltolarsen exhibits plasma protein binding of 39-40%, and this binding is not dependent on the drug's concentration. This contrasts sharply with other ASO chemistries, such as phosphorothioates, which are highly protein-bound and have longer plasma half-lives. The low protein binding of viltolarsen contributes to its rapid clearance from the plasma.
• Tissue Distribution: Preclinical studies using radiolabeled viltolarsen in animal models have provided insights into its tissue disposition. Following IV administration, the drug distributes widely, with the highest concentrations consistently observed in the kidney cortex, the primary organ of elimination. Concentrations in skeletal and cardiac muscle, the target tissues for therapeutic effect, are substantially lower than in the kidney. However, studies in DMD model mice have shown that viltolarsen concentrations are higher in dystrophic muscle compared to healthy muscle, suggesting a potential for preferential uptake or retention in the target tissue.

Metabolism

Viltolarsen is characterized by its high metabolic stability. The phosphorodiamidate morpholino backbone is specifically engineered to be resistant to degradation by both endonucleases and exonucleases, the enzymes that typically break down nucleic acids. Furthermore, viltolarsen does not undergo metabolism by the cytochrome P450 (CYP) enzyme system in the liver. As a result, the drug is not subject to significant metabolic breakdown and is expected to be eliminated from the body primarily in its unchanged, parent form.

Excretion

The primary route of elimination for viltolarsen is renal excretion.

• Route of Elimination: The drug is rapidly cleared from the plasma and excreted in the urine. Clinical data from a study in Japanese DMD patients showed that 92-93% of an administered dose was recovered unchanged in the urine within 24 hours of infusion, confirming that renal excretion is the predominant clearance pathway.
• Half-Life and Clearance: Viltolarsen has a very short elimination half-life (t1/2​), reported to be approximately 2.5 hours. Concordantly, its plasma clearance is rapid, with a reported value of 217 mL/hr/kg.

The pharmacokinetic profile of viltolarsen reveals a notable disparity between its rapid clearance from the bloodstream and its once-weekly dosing schedule. The drug's short 2.5-hour half-life means it is almost completely cleared from the plasma well before the next dose is administered. This is reconciled by the understanding that the therapeutic effect is not dependent on sustained plasma concentrations of the drug itself. Instead, the weekly dosing regimen is effective because of the long biological half-life of the newly synthesized, relatively stable dystrophin protein that results from the drug's transient action in the muscle cell nucleus. This indicates that the critical pharmacokinetic parameter is not plasma exposure but rather the drug's ability to reach its intracellular target and initiate a durable pharmacodynamic response.

Clinical Development Program and Efficacy Analysis

Early Phase and Dose-Finding Studies

The clinical development of viltolarsen began with early-phase studies designed to assess its safety, tolerability, and pharmacokinetic profile, and to identify an effective dose. A Phase 1 study (NCT02081625) and a Phase 1/2 study in Japan (Japic CTI-163291) were conducted in boys with DMD. These initial trials demonstrated that viltolarsen was generally well-tolerated and showed a dose-dependent increase in both exon 53 skipping at the mRNA level and dystrophin protein expression in muscle biopsies. The data from these studies supported the selection of the 40 mg/kg and 80 mg/kg once-weekly intravenous doses for further investigation, with the 80 mg/kg dose ultimately becoming the recommended therapeutic dose.

The Pivotal Phase 2 Study (NCT02740972) and Long-Term Extension (LTE, NCT03167255)

The cornerstone of viltolarsen's accelerated approval was a pivotal Phase 2 study conducted in North America.

• Design: This study enrolled 16 ambulatory boys with DMD, aged 4 to 9 years, with mutations amenable to exon 53 skipping. Patients were treated with either 40 mg/kg or 80 mg/kg of viltolarsen weekly. The primary efficacy endpoint was the change in dystrophin levels from baseline, measured in muscle biopsies. Motor function was assessed as a secondary endpoint and compared to data from a matched external control group from the Cooperative International Neuromuscular Research Group Duchenne Natural History Study (CINRG DNHS).
• Outcomes: The study successfully met its primary endpoint. At the 80 mg/kg dose, treatment with viltolarsen led to a statistically significant increase in dystrophin protein to a mean of 5.9% of normal levels after 24 weeks, a substantial increase from the 0.6% baseline. Following the initial study, all 16 participants enrolled in a long-term extension (LTE) study (NCT03167255). Data from the LTE, which followed patients for over four years, suggested a clinical benefit. Viltolarsen-treated participants showed a stabilization of motor function, with statistically significant differences observed in key measures like Time to Stand (TTSTAND) when compared to the progressive decline seen in the historical control cohort. These positive findings on both the surrogate endpoint and functional outcomes relative to historical controls provided the evidence base for the FDA's accelerated approval in 2020.

The Confirmatory Phase 3 RACER53 Trial (NCT04060199)

As a condition of its accelerated approval, NS Pharma was required to conduct a larger, more rigorous trial to confirm the clinical benefit of viltolarsen.

• Design: The RACER53 study was a global, randomized, double-blind, placebo-controlled Phase 3 trial. It enrolled 77 ambulatory boys with DMD, aged 4 to 7 years. This design represents the gold standard for clinical evidence, intended to definitively establish efficacy by comparing the drug against a concurrent placebo group rather than a historical cohort.
• Primary Endpoint: The primary endpoint was the change in Time to Stand from Supine (TTSTAND), evaluated as velocity (the speed at which a patient rises), measured over a 48-week treatment period.
• Preliminary Outcomes (May 2024): The trial failed to meet its primary endpoint. The preliminary analysis revealed that while the viltolarsen-treated group showed a trend of improvement in TTSTAND velocity from baseline, the placebo group also showed a similar trend of improvement. Consequently, there was no statistically significant difference between the active treatment and placebo arms. The safety profile observed in RACER53 was consistent with previous studies and raised no new concerns.

Ancillary Studies (Galactic53, NCT04956289)

To explore the potential benefits of viltolarsen in a broader population, NS Pharma initiated the Galactic53 study. This Phase 2, open-label trial evaluated the standard 80 mg/kg weekly dose in both ambulatory and non-ambulatory males with DMD. It was the first study of viltolarsen to formally assess pulmonary function as an endpoint. The results showed a stabilization of upper limb motor function over 49 weeks in both patient groups and provided initial evidence of a meaningful benefit in pulmonary function, suggesting the drug's potential utility in later stages of the disease.

The conflicting outcomes between the Phase 2/LTE and the Phase 3 RACER53 trial highlight the challenges of drug development in DMD and the limitations of using historical controls. The juxtaposition of these trials, detailed in Table 2, forms the central dilemma in assessing the true clinical value of viltolarsen.

Table 2: Summary of Key Clinical Trials for Viltolarsen

Safety and Tolerability Assessment

Overview of the Integrated Safety Database

The safety profile of viltolarsen has been evaluated across its clinical development program. The initial approval was based on data from 32 patients, some of whom have now been treated for over four years in long-term extension studies. The larger RACER53 trial, which included 77 participants, further expanded the safety database and confirmed the drug's generally favorable tolerability profile. Across all studies, treatment-emergent adverse events (TEAEs) have been predominantly mild or moderate in severity, and no new safety signals emerged in the confirmatory trial.

Common and Clinically Significant Adverse Reactions

The most frequently reported adverse reactions observed in patients treated with viltolarsen (with an incidence of 15% or greater) include :

• Upper respiratory tract infection: This includes related terms such as nasopharyngitis and rhinorrhea.
• Injection site reaction: Manifestations include bruising, erythema (redness), swelling, or other reactions at the site of the intravenous infusion.
• Cough
• Pyrexia (fever)

Other reported adverse events include diarrhea, arthralgia (joint pain), and urticaria (hives). In the long-term extension study, events consistent with a pediatric DMD population, such as falls and bone fractures, were also reported but were not considered related to the study drug.

Warnings and Precautions: Renal Toxicity

A significant point of emphasis in the safety monitoring of viltolarsen is the potential for renal toxicity. This concern arises not from direct observations in human trials but from a combination of preclinical data and a known class effect of some antisense oligonucleotides.

• Preclinical Findings: Animal studies involving viltolarsen demonstrated dose-dependent renal toxicity, including renal tubular effects, particularly at high doses.
• ASO Class Effect: The FDA label for viltolarsen explicitly notes that kidney toxicity, including potentially fatal glomerulonephritis, has been observed following the administration of some other ASO drugs. This history has created a high level of regulatory scrutiny for all drugs in this class.
• Clinical Experience: Importantly, despite the preclinical and class-effect concerns, kidney toxicity was not observed in any of the human clinical studies of viltolarsen.

Nevertheless, due to the potential risk, the prescribing information includes a formal warning and mandates a rigorous renal function monitoring protocol. This represents a case where the management of a drug's safety is dictated as much by the perceived risk of its therapeutic class as by its own demonstrated clinical safety profile.

Required Clinical Monitoring

To mitigate the potential risk of kidney toxicity, the following monitoring schedule is required for all patients receiving viltolarsen:

• Baseline Assessment (Before Starting Therapy):
• Measure serum cystatin C, conduct a urine dipstick test, and determine the urine protein-to-creatinine ratio (UPCR).
• Consider measuring the glomerular filtration rate (GFR) using an exogenous filtration marker.
• It is noted that serum creatinine is an unreliable measure of kidney function in DMD patients due to their significantly reduced skeletal muscle mass.
• Ongoing Monitoring (During Treatment):
• Monitor urine dipstick every month.
• Monitor serum cystatin C and UPCR every three months.
• To prevent false positive results for proteinuria (as the drug is excreted in urine and can interfere with certain lab reagents), urine samples for testing should be collected either immediately prior to the next infusion or at least 48 hours after the most recent infusion.

If a persistent increase in serum cystatin C or proteinuria is detected, a referral to a pediatric nephrologist for further evaluation is recommended.

Dosing, Administration, and Patient Management

Recommended Dosing Regimen

The approved dosage of viltolarsen is 80 mg per kg of body weight. This dose is administered once weekly, consistently, to maintain the therapeutic effect of dystrophin production. The dosing regimen is the same for both pediatric and adult patients who meet the indication criteria. In the event of a missed dose, it is recommended that the dose be administered as soon as possible.

Guidelines for Intravenous Administration

Viltolarsen is supplied as a sterile solution for injection in single-dose vials, with a concentration of 250 mg in 5 mL (50 mg/mL). Proper handling and administration procedures are critical for safety and efficacy.

• Preparation: Vials should be allowed to warm to room temperature before preparation. The required volume of viltolarsen is calculated based on the patient's body weight. Depending on this volume, the drug may need to be diluted with 0.9% Sodium Chloride Injection, USP. If the calculated drug volume is less than 100 mL, it should be added to a 100 mL infusion bag of 0.9% sodium chloride from which an equivalent volume of saline has been removed, to achieve a total infusion volume of 100 mL. If the drug volume is 100 mL or more, no dilution is necessary, and the drug can be placed directly into an empty infusion bag.
• Administration: The infusion is administered intravenously over a period of 60 minutes. It can be delivered via a peripheral or a central venous catheter. Filtration of the solution is not required.
• Compatibility: Viltolarsen should only be mixed with 0.9% Sodium Chloride Injection. It must not be mixed with other medications, nor should other drugs be infused concomitantly through the same intravenous line. After the infusion is complete, the IV line should be flushed with 0.9% Sodium Chloride Injection.

Regulatory Trajectory and Market Access

U.S. Food and Drug Administration (FDA)

The regulatory journey of viltolarsen in the United States has been characterized by the use of expedited pathways designed for serious and rare diseases.

• Designations: The FDA granted viltolarsen several key designations to facilitate its development and review, including Orphan Drug designation (January 2017), Priority Review, Fast Track designation, and Rare Pediatric Disease designation.
• Accelerated Approval: On August 12, 2020, the FDA granted accelerated approval to viltolarsen for the treatment of DMD in patients with a confirmed mutation of the DMD gene amenable to exon 53 skipping. This approval was based on the surrogate endpoint of increased dystrophin production in skeletal muscle, which was deemed "reasonably likely to predict clinical benefit".
• Post-Marketing Requirement and Current Status: A critical condition of the accelerated approval was the requirement for a post-marketing confirmatory trial to verify the drug's clinical benefit. The failure of the designated trial, RACER53, to meet its primary endpoint in May 2024 has placed the drug's continued approval in significant jeopardy. NS Pharma is currently in discussions with the FDA to determine the path forward, which could involve further data analysis, additional studies, or a potential withdrawal of the approval.

Pharmaceuticals and Medical Devices Agency (PMDA) of Japan

Viltolarsen achieved its first global regulatory approval in Japan. On March 25, 2020, the PMDA approved the drug for the same indication under its Conditional Early Approval System, a pathway analogous to the FDA's accelerated approval.

European Medicines Agency (EMA)

Viltolarsen is not currently approved for marketing in the European Union. Its regulatory progress in Europe has been more preliminary.

• The European Commission granted viltolarsen Orphan Drug designation in June 2020, which provides incentives for development.
• In March 2022, the EMA's Paediatric Committee (PDCO) agreed to a Paediatric Investigation Plan (PIP) for viltolarsen. A PIP is a mandatory step for any new medicine to be considered for marketing authorization in Europe. The negative outcome of the RACER53 trial will likely present a significant challenge for any future marketing authorization application to the EMA.

Economics

The cost of treatment with viltolarsen is substantial, reflecting the high price of therapies for rare and ultra-rare diseases. The estimated annual cost is approximately US$733,000 for a patient weighing 30 kilograms (66 lb).

The key regulatory milestones are summarized chronologically in Table 3.

Table 3: Regulatory Milestones for Viltolarsen

Date	Regulatory Agency	Action/Decision	Significance/Note
Jan 12, 2017	U.S. FDA	Granted Orphan Drug Designation	Provided incentives for development for a rare disease.
Mar 25, 2020	Japan PMDA	Granted Conditional Early Approval	First global approval for viltolarsen.
Jun 05, 2020	European Commission	Granted Orphan Drug Designation	Provided development and marketing incentives in the EU.
Aug 12, 2020	U.S. FDA	Granted Accelerated Approval	Approval based on surrogate endpoint of dystrophin increase; required a confirmatory trial.
Mar 11, 2022	EMA	Agreed to Paediatric Investigation Plan (PIP)	A mandatory step for future marketing authorization application in the EU.
May 27, 2024	N/A (NS Pharma)	Announced Preliminary RACER53 Results	Confirmatory trial failed to meet its primary clinical endpoint, jeopardizing continued FDA approval.

Therapeutic Context and Comparative Analysis

Viltolarsen's Position in the DMD Treatment Paradigm

Viltolarsen is a mutation-specific, disease-modifying therapy that targets the underlying genetic cause of DMD in a specific subpopulation of patients. It is not a standalone treatment but is intended to be used as part of a comprehensive management plan. In clinical trials, all participants were on a stable dose of corticosteroids (e.g., prednisone or deflazacort), which remain the standard of care for DMD. Corticosteroids provide broad anti-inflammatory and muscle-strengthening benefits, slowing disease progression for all patients regardless of their specific mutation. Viltolarsen is administered adjunctively with the goal of providing an additional, targeted benefit by restoring partial dystrophin production. It is not a cure but aims to slow the rate of functional decline.

Comparative Assessment with Golodirsen (Vyondys 53)

In the therapeutic landscape, viltolarsen's most direct competitor is golodirsen (Vyondys 53), another ASO approved for the same indication.

• Similarity: Both viltolarsen and golodirsen are PMO-based ASOs that share the exact same mechanism of action: inducing the skipping of exon 53 to treat DMD. Both were granted accelerated approval by the FDA based on the surrogate endpoint of dystrophin production and require confirmatory trials to establish clinical benefit.
• Structural Difference: While both are PMOs, they differ in their nucleotide length. Viltolarsen is a 21-mer, whereas golodirsen is a 25-mer. This structural difference could potentially influence properties such as molar concentration per dose, binding affinity, or off-target effects, though the clinical relevance of this is not fully established.
• Efficacy on Surrogate Endpoint: A key point of differentiation in the available data is the reported magnitude of dystrophin restoration. Published data from viltolarsen's pivotal study showed a mean increase in dystrophin to approximately 6% of normal levels. In contrast, publicly available materials for golodirsen's approval indicate a mean increase to approximately 1% of normal. This six-fold difference in dystrophin production has been a significant point of discussion among clinicians and researchers, although the direct correlation between the percentage of dystrophin and the degree of clinical benefit remains an area of active investigation.

The failure of viltolarsen's RACER53 trial to confirm clinical benefit casts a shadow not only on viltolarsen but also on golodirsen, as both rely on the same therapeutic hypothesis. The outcome of golodirsen's own confirmatory trial will be watched with intense interest. A comparison of the two therapies is provided in Table 4.

Table 4: Comparison of Viltolarsen (Viltepso) and Golodirsen (Vyondys 53)

Conclusion and Future Outlook

Synthesis of Viltolarsen's Clinical Profile

Viltolarsen stands as a testament to the power of rational drug design in the era of genetic medicine. It is an exquisitely engineered molecule that has unequivocally demonstrated its ability to achieve its primary biochemical objective: to engage its target on the DMD pre-mRNA, induce the skipping of exon 53, and restore the production of dystrophin protein in patients with amenable mutations. The consistency of this effect across treated patients in early-phase trials was the foundation of its regulatory approvals in Japan and the United States.

However, the clinical development narrative of viltolarsen is now defined by a profound and challenging discordance. The recent failure of the rigorous, placebo-controlled Phase 3 RACER53 trial to translate this biochemical success into a statistically significant clinical benefit on a key motor function endpoint has cast a long shadow over the drug's future. Viltolarsen is therefore a therapy at a critical inflection point, embodying the immense challenge of bridging the gap between a measurable molecular effect and a meaningful clinical outcome in the complex and variable landscape of a rare, progressive disease.

The Surrogate Endpoint Dilemma

The story of viltolarsen serves as a crucial and cautionary case study on the promise and peril of the FDA's accelerated approval pathway. This pathway was created to expedite patient access to potentially life-altering therapies for serious conditions with unmet needs, allowing for approval based on surrogate endpoints that are "reasonably likely" to predict clinical benefit. Viltolarsen's approval based on dystrophin production was a prime example of this pathway in action.

The subsequent failure of the RACER53 trial to confirm clinical benefit brings the central question of this pathway into sharp focus: what happens when the surrogate is not, in fact, predictive of the clinical outcome in a robust trial? This outcome forces the scientific and regulatory communities to confront difficult questions. Is the level of dystrophin production induced by viltolarsen (~6% of normal) simply insufficient to alter the disease course in a clinically detectable way over 48 weeks? Is dystrophin quantity, as measured by Western blot, an inadequate surrogate, and should measures of protein function or localization be prioritized? Alternatively, are the chosen clinical endpoints, such as TTSTAND, too variable in a young, corticosteroid-treated population to reliably detect a modest drug effect against a background of high inter-patient variability in disease progression?

Future Directions and Unanswered Questions

The immediate future of viltolarsen is uncertain and will be determined by two parallel processes: a deep scientific re-interrogation of the existing data and complex negotiations with regulatory authorities. NS Pharma will conduct extensive post-hoc and subgroup analyses of the RACER53 data to search for any signals of efficacy that may have been missed in the primary analysis, such as benefits in specific age groups, on secondary endpoints, or in patients with different baseline characteristics.

The FDA now faces a difficult decision regarding viltolarsen's continued marketing status. The agency must weigh the unmet need in the DMD community and the drug's demonstrated molecular effect and favorable safety profile against the clear failure of the confirmatory trial. The outcome of this decision will have profound ripple effects, influencing not only the future of viltolarsen but also the regulatory viability of other exon-skipping therapies and the broader application of the accelerated approval pathway for neuromuscular diseases. The path forward for viltolarsen will depend on whether a compelling case can still be made for its clinical value in the face of a challenging and unambiguous clinical trial result.

Works cited

1. Viltolarsen: Uses, Interactions, Mechanism of Action | DrugBank Online, accessed September 14, 2025, https://go.drugbank.com/drugs/DB15005
2. Viltolarsen - PubChem, accessed September 14, 2025, https://pubchem.ncbi.nlm.nih.gov/compound/Viltolarsen
3. Pharmacological Profile of Viltolarsen for the Treatment of Duchenne Muscular Dystrophy: A Japanese Experience - PMC - PubMed Central, accessed September 14, 2025, https://pmc.ncbi.nlm.nih.gov/articles/PMC8688746/
4. viltolarsen | Ligand page | IUPHAR/BPS Guide to PHARMACOLOGY, accessed September 14, 2025, https://www.guidetopharmacology.org/GRAC/LigandDisplayForward?ligandId=11430
5. What is Viltepso's mechanism of action? - Drugs.com, accessed September 14, 2025, https://www.drugs.com/medical-answers/viltepsos-mechanism-action-3555181/
6. Viltolarsen - LiverTox - NCBI Bookshelf, accessed September 14, 2025, https://www.ncbi.nlm.nih.gov/books/NBK588132/
7. FDA Grants Accelerated Approval to Viltepso (viltolarsen), accessed September 14, 2025, https://www.parentprojectmd.org/fda-grants-accelerated-approval-to-viltepso-viltolarsenfirst-targeted-treatment-for-viltepso-viltolarsen/
8. NS Pharma Shares Preliminary Results of Viltolarsen (NS-065 ..., accessed September 14, 2025, https://www.nspharma.com/ns-pharma-shares-preliminary-results-of-viltolarsen-ns-065-ncnp-01-phase-3-clinical-trial-racer53-study/
9. Preliminary results of the RACER53 Phase 3 study for boys with Duchenne muscular dystrophy, accessed September 14, 2025, https://www.musculardystrophyuk.org/news/racer53-phase-3-study-viltepso-results/
10. Report on the Deliberation Results March 6, 2020 Pharmaceutical Evaluation Division, Pharmaceutical Safety and Environmental Hea - PMDA, accessed September 14, 2025, https://www.pmda.go.jp/files/000237467.pdf
11. Viltepso (viltolarsen) for Duchenne muscular dystrophy, accessed September 14, 2025, https://musculardystrophynews.com/viltepso-viltolarsen/
12. Viltolarsen - Wikipedia, accessed September 14, 2025, https://en.wikipedia.org/wiki/Viltolarsen
13. Muscular Dystrophy Association Celebrates FDA Approval of ..., accessed September 14, 2025, https://www.mda.org/press-releases/muscular-dystrophy-association-celebrates-fda-approval-viltolarsen-treatment-duchenne
14. How Does Exon Skipping Work in Patients with DMD | VYONDYS 53, accessed September 14, 2025, https://www.vyondys53.com/what-is-vyondys53/how-it-works
15. VILTEPSO™ - Parent Project Muscular Dystrophy, accessed September 14, 2025, https://www.parentprojectmd.org/drug-development-pipeline/viltolarsen-ns-065-ncnp-01/
16. An exon-skipping treatment option for DMD patients with ... - Viltepso, accessed September 14, 2025, https://www.viltepso.com/pdf/Exon_Skipping_Overview.pdf
17. What is the mechanism of Viltolarsen?, accessed September 14, 2025, https://synapse.patsnap.com/article/what-is-the-mechanism-of-viltolarsen
18. VILTOLARSEN - precisionFDA, accessed September 14, 2025, https://precision.fda.gov/ginas/app/ui/substances/af332560-7cbd-4de4-99eb-61a33d32d01f
19. Clinical Pharmacokinetics of Approved RNA Therapeutics - PMC - PubMed Central, accessed September 14, 2025, https://pmc.ncbi.nlm.nih.gov/articles/PMC9821128/
20. Golodirsen for Duchenne Muscular Dystrophy - PMC, accessed September 14, 2025, https://pmc.ncbi.nlm.nih.gov/articles/PMC7133412/
21. HIGHLIGHTS OF PRESCRIBING INFORMATION These ... - Viltepso, accessed September 14, 2025, https://viltepso.com/wp-content/uploads/2025/06/Viltepso_Prescribing-Information.pdf
22. CAS 2055732-84-6 Viltolarsen - Alfa Chemistry, accessed September 14, 2025, https://www.alfachemic.com/oligonucleotide-therapeutics/product/viltolarsen-cas-2055732-84-6-496819.html
23. 2055732-84-6 | Viltolarsen - ChemScene, accessed September 14, 2025, https://www.chemscene.com/2055732-84-6.html?productObj=CS-0204196
24. Viltolarsen (NS-065/NCNP-01) | Antisense Oligonucleotide | MedChemExpress, accessed September 14, 2025, https://www.medchemexpress.com/viltolarsen.html
25. Viltepso (viltolarsen) FDA Approval History - Drugs.com, accessed September 14, 2025, https://www.drugs.com/history/viltepso.html
26. HY-132586-1mg | Viltolarsen [2055732-84-6] Clinisciences, accessed September 14, 2025, https://www.clinisciences.com/-186/viltolarsen-2055732-84-6-231103443.html
27. Annotation of FDA Label for viltolarsen and DMD - ClinPGx, accessed September 14, 2025, https://www.clinpgx.org/labelAnnotation/PA166236521
28. Viltolarsen - New Drug Approvals, accessed September 14, 2025, https://newdrugapprovals.org/2020/12/09/viltolarsen/
29. Viltolarsen Phase II Study - NeurologyLive, accessed September 14, 2025, https://www.neurologylive.com/view/viltolarsen-phase-ii-study
30. VILTEPSO (viltolarsen) injection - This label may not be the latest approved by FDA. For current labeling information, please visit https://www.fda.gov/drugsatfda, accessed September 14, 2025, https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/212154s000lbl.pdf
31. Prediction of Human Pharmacokinetics of Phosphorodiamidate Morpholino Oligonucleotides in Duchenne Muscular Dystrophy Patients Using Viltolarsen - ResearchGate, accessed September 14, 2025, https://www.researchgate.net/publication/372480338_Prediction_of_human_pharmacokinetics_of_phosphorodiamidate_morpholino_oligonucleotides_in_Duchenne_muscular_dystrophy_patients_using_viltolarsen
32. 212154Orig1s000 | FDA - accessdata.fda.gov, accessed September 14, 2025, https://www.accessdata.fda.gov/drugsatfda_docs/nda/2020/212154Orig1s000PharmR.pdf
33. Viltolarsen Completed Phase 1 Trials for Duchenne Muscular Dystrophy (DMD) Treatment, accessed September 14, 2025, https://go.drugbank.com/drugs/DB15005/clinical_trials?conditions=DBCOND0040032&phase=1&purpose=treatment&status=completed
34. CDER-Approved NDA for VILTEPSO® (viltolarsen) - Evidence Hub, accessed September 14, 2025, https://evidence-hub.aetion.com/fda-decision-alerts/cder-approved-nda-for-viltepso-viltolarsen/
35. Long-Term Functional Efficacy and Safety of Viltolarsen in Patients with Duchenne Muscular Dystrophy - PubMed Central, accessed September 14, 2025, https://pmc.ncbi.nlm.nih.gov/articles/PMC9398057/
36. Efficacy and Safety of Viltolarsen in Boys With Duchenne Muscular ..., accessed September 14, 2025, https://pmc.ncbi.nlm.nih.gov/articles/PMC10200237/
37. DMD: positive results from Viltolarsen confirmed over four years - Institut de Myologie, accessed September 14, 2025, https://www.institut-myologie.org/en/2023/09/07/dmd-positive-results-from-viltolarsen-confirmed-over-four-years/
38. NS Pharma Shares Update on VILTEPSO® (Viltolarsen) Phase 3 Study, accessed September 14, 2025, https://www.parentprojectmd.org/ns-pharma-shares-update-on-viltepso-viltolarsen-phase-3-study/
39. NS Pharma, Inc. Shares, New VILTEPSO® (Viltolarsen) Data at the MDA Clinical & Scientific Conference 2024, accessed September 14, 2025, https://www.nspharma.com/ns-pharma-inc-shares-new-viltepso-viltolarsen-data-at-the-mda-clinical-scientific-conference-2024/
40. Viltolarsen Monograph for Professionals - Drugs.com, accessed September 14, 2025, https://www.drugs.com/monograph/viltolarsen.html
41. Viltolarsen Dosage Guide + Max Dose, Adjustments - Drugs.com, accessed September 14, 2025, https://www.drugs.com/dosage/viltolarsen.html
42. Viltepso (viltolarsen) - Iowa Department of Health and Human Services, accessed September 14, 2025, https://hhs.iowa.gov/media/421/download?inline
43. Search Orphan Drug Designations and Approvals - FDA, accessed September 14, 2025, https://www.accessdata.fda.gov/scripts/opdlisting/oopd/detailedIndex.cfm?cfgridkey=565616
44. Viltolarsen Earns European Orphan Drug Designation as DMD Treatment, accessed September 14, 2025, https://musculardystrophynews.com/2020/06/11/viltolarsen-orphan-drug-status-duchenne-md-treatment-europe/
45. Viltolarsen: First Approval - PubMed, accessed September 14, 2025, https://pubmed.ncbi.nlm.nih.gov/32519222/
46. Union Register of medicinal products - Public health - European Commission, accessed September 14, 2025, https://ec.europa.eu/health/documents/community-register/html/o2282.htm
47. EMEA-002853-PIP01-20 - paediatric investigation plan | European ..., accessed September 14, 2025, https://www.ema.europa.eu/en/medicines/human/paediatric-investigation-plans/emea-002853-pip01-20
48. Vyondys 53 (golodirsen) vs Viltepso (viltolarsen) - Everyone.org, accessed September 14, 2025, https://everyone.org/explore/compare?id1=377&id2=378
49. FDA approves viltolarsen (Viltepso) for Duchenne muscular dystrophy - The Hospitalist, accessed September 14, 2025, https://blogs.the-hospitalist.org/content/fda-approves-viltolarsen-viltepso-duchenne-muscular-dystrophy
50. What is the therapeutic class of Viltolarsen?, accessed September 14, 2025, https://synapse.patsnap.com/article/what-is-the-therapeutic-class-of-viltolarsen