Genetics of Self-injurious Behaviour
- Conditions
- Self Injurious Behavior Without Suicidal IntentSelf-Injurious Behavior
- Interventions
- Genetic: DNA extraction and genotyping of candidate genetic polymorphismsOther: self-assessment questionnaires
- Registration Number
- NCT05563324
- Lead Sponsor
- University Medical Centre Maribor
- Brief Summary
Nonsuicidal Self-Injury (NSSI) is being increasingly regarded as a separate psychiatric disorder. Since the latest Diagnostic and Statistical Manual of Mental Disorders - DSM-5 from 2013 defined NSSI as a separate diagnosis under section III - Conditions for Further Study, the knowledge about this field has increased considerably; however, the aetiology of this behaviour has still not been explained. There are many psychological explanations for the development and the continuation of NSSI. Researchers have identified the most common comorbidities (depression, borderline personality disorder, anxiety). The causes of NSSI are not known, although studies that have been carried out so far indicate both genetic and environmental factors.
The research included 95 adolescents with NSSI (participants were diagnosed based on the DSM-5 criteria), an original control group consisting of 21 people without NSSI, and 118 individuals from the general population as an additional control group for genetic research. For all participants we carried out the genotyping of polymorphisms for the TPH1 (rs4537731, rs1799913, rs7933505), SLC6A4 (VNTR STin2), OPRM1 (rs1799971), GNβ3 (rs5443) and DRD2/ANKK1 (rs1800497) genes. The participants with NSSI and the control group without NSSI completed translated questionnaires for the Barratt Impulsiveness Scale (BIS-11), State-Trait Anxiety Inventory for Adults (STAI), MacLean Screening Instrument for BPD (MSI-BPD) and the Early Trauma Inventory Self Report-Short Form (ETISR-SF). The participants with NSSI also completed the questionnaire for the Inventory of Statements about Self-Injury (ISAS), and the Self-Injury Craving Questionnaire (SICQ). The investigators carried out an association analysis and G x E analyses.
The aim of the research was to carry out the first G x E study on the etiology of NSSI in Slovene adolescents. We have hypothesized that NSSI could be associated with one of the candidate polymorphisms or a combination of candidate polymorphisms. Further we have hypothesized that the genetic polymorphisms associated to NSSI are the most connected to NSSI in traumatised individuals and that NSSI is associated with higher impulsivity.
- Detailed Description
Theoretical background The etiology of Nonsuicidal Self-Injury (NSSI) has still not been explained. Studies that have been carried out so far indicate both genetic and environmental factors. It has been suggested, that NSSI is a polygenic disorder. Two neurotransmitter systems, the serotonergic system and the endogen opioids system, are the main candidate systems in the etiology of NSSI.
The serotonin system is important in comorbid disorders of NSSI (depression, anxiety...). There is also growing importance of its direct involvement in NSSI. Deficiency of tryptophan, a precursor of serotonin, has been connected with increasing frequency of NSSI. Variable-number tandem repeat polymorphism of the serotonin transporter gene - SLC6A4 (VNTR STin2) has been associated with borderline personality disorder, a disorder with frequent NSSI, in one study. The are some important polymorphisms of the gene for the tryptophan hydroxylase enzyme, the main enzyme in the synthesis of serotonin. The polymorphism rs1799913 has been associated with depression and with parasuicidal behavior. This polymorphism is, together with some other polymorphisms (e.g. rs4537731, rs7933505), a part of a haplotype. This haplotype has already shown some connections with borderline personality disorder.
There is also growing evidence that the changes in concentration of endogenous opioids (EO) could be associated with NSSI. Significantly lower β-endorphin and met-enkephalin values in the liquor of individuals with NSSI had been demonstrated. A recent study has shown significantly lower basal β-endorphin levels in adolescents with NSSI, when compared to healthy controls. Naomi I. Eisenberger is a leader in studying polymorphisms of endogenous opioids in conjunction with "emotional" pain. People with a lower threshold for physical pain also described a greater sensitivity to emotional pain. There is numerous evidence of the significant effect of the polymorphism of the gene for the mu-opioid receptor OPRM1 (A118G; rs1799971) on altered sensitivity to physical pain, pain perception and response to opiate analgesics. A significantly increased sensitivity of G allele carriers to social rejection (i.e. on a model for "emotional" pain) has been demonstrated. A number of studies have been conducted on the impact of the rs1799971 polymorphism on craving and addiction. Given the theoretical addictive background of NSSI and the interconnectedness of physical and emotional pain and the role of the rs1799971 polymorphism, this polymorphism is an important candidate polymorphism in NSSI. For individual addictions, different, partly conflicting results appear. Various studies have confirmed the G allele as a risk factor for various addictions, while others have not demonstrated any impact or have found a reduced risk of addiction in G allele carriers. Thus, in 2016, the first collaborative analysis was carried out in which 9064 subjects of the Caucasian population were included. In this large, European sample, the G allele proved to be a significant (OR = 0.90; confidence interval 95 % (0.83 - 0.97); p = 0.0095) protective factor for addiction in general. Direct studies of craving and the impact of rs1799971 on craving are rare and contradictory. There has been little research on potential genetic influences on the development of NSSI and rs1799971 does not appear to have been studied in this field.
The main target of antipsychotics, the dopamine receptor D2, is also important in the research of addiction. The most famous polymorphism of the dopamine receptor 2 gene is the Taq1A (TaqIA) (rs1800497) polymorphism. Two alleles of rs1800497 are known - A1 and A2. Allele A1 has been associated with pathological gambling, a typical behavioral addiction, in one study. It has also been associated with impulsivity and addictive behavior in some other studies. The A1 allele has also been associated with borderline personality traits. G - proteins have been connected with the proper activity of numerous receptors. The polymorphism C825T (rs5443) of the G protein beta 3 gene (GNbeta3) has in some research been connected with depression. In one study, the T allele carriers had a statistical higher risk for NSSI as other depressive patients.
Diminished pain perception and a higher pain threshold in people with NSSI have been shown.
Ethics committee approval and project registration The study has been approved by the Medical Ethics Committee of the Republic of Slovenia (number 69/06/13). It has been chosen and registered as an internal scientific research and developmental project of the University Medical Centre Maribor, Slovenia, on 1.8.2013 (project number IRP-2013/01-07).
Questionnaires All adolescents from the clinical sample and the original control group filled out the Slovenian version of the self-assessment questionnaire of the State-Trait Anxiety Inventory for Adults (STAI) and the following questionnaires, translated into Slovene: Barratt Impulsiveness Scale (BIS-11), MacLean Screening Instrument for BPD (MSI-BPD), Early Trauma Inventory Self Report-Short Form (ETISR-SF). The STAI measures two forms of anxiety. "State anxiety" measures the current state, i.e. the level of anxiety that the individual feels at a given event. "Trait anxiety" refers to the long-term state of the individual. BIS-11 is probably the most frequently used instrument for the measurement of impulsivity. The MSI-BPD is a screening questionnaire used to search for borderline personality disorder in adolescence. ETISR-SF measures the childhood trauma, including physical, emotional and sexual abuse, as well as general traumatic events.
In order to identify NSSI, the investigators used the Slovenian translation of the Inventory of Statements about Self-Injury (ISAS) and the Slovenian translation of the Self-Injury Craving Questionnaire (SICQ) for the clinical sample. The ISAS is a questionnaire consisting of two parts. The first part consists of 12 questions about self-injurious behavior and the second part of questions about 13 functions of NSSI. The SICQ contains 7 questions about the craving for NSSI.
DNA extraction and genotyping There is little research about genetics of NSSI. Some candidate genetic polymorphisms had been chosen with the help of this information. Predominantly, the candidate genetic polymorphisms in the study have therefor been chosen with the help of information about genetics of addiction and comorbid disorders (depression, borderline personality disorder, ...).
DNA for genotyping was extracted from peripheral blood mononuclear cells using TRI-reagent (Sigma, Steinheim, Germany) according to manufacturer's instructions. Quality and concentration of extracted DNA was checked using agarose gel electrophoresis and SynergyTM 2 (Biotek, Winooski, VT, USA) spectrophotometer.
For the genotyping of the polymorphisms, the investigators first performed the real-time polymerase chain reaction (qPCR) and then the high resolution melting (HRM) or the restriction fragment length polymorphism (RFLP) method. The qPCR was performed as follows: denaturation at 95 °C for 10 min, multiplication, 45 cycles of 95°C 10 s, 60°C 15 s, 72°C 10 s. The HRM has been made at the following protocol: 95°C 1 min, 40°C 1 min, 60 - 90°C at 0,02 °C/s and cooling at 40°C for 10 s. The HRM reaction has been made with the LightCycler® 480 (Roche) and the LC480 HRM Master Mix (Roche) has been used. The investigators have analyzed the genotypes from the melting curves (TABLE 1). In the RFLP protocol, the product of the qPCR has been incubated with the right restriction enzyme from New England Biolabs (TABLE 1). Analysis has been done with agarose gel electrophoresis (2 % agarose gel, tris borate EDTA buffer). The DNA samples were mixed with 0.25% xylene cyanol and 40% sucrose. Electrophoresis has been run at 150 V for 20 minutes. At the end, the agarose gel has been analyzed under the UV light.
Gene; genetic polymorphism; sequence of the primer; temperature; genotyping method; restriction enzyme:
1. OPRM1; rs1799971; CGGTTCCTGGGTCAACTTGT, GATCGTGATGGCCGTGAT; 60 °C; HRM; /.
2. TPH1; rs4537731; GTTTCATGCAGGTATTAGTG, TGGCATTGAAGTAAGAGCAC; 60 °C; RFLP; Sau3AI.
3. TPH1; rs1799913; GTTAAGCACTGCAGCGTGAC, AAGCGGGACATGACCTAAGA; 60 °C; HRM; /.
4. TPH1; rs7933505; AAACTGAGAGGAAAATGCTTGC, CATTGCCGTTGAACTTTTGA; 65 °C; RFLP; NlaIII.
5. DRD2; rs1800497; CTTGCCCTCTAGGAAGGACAT, ACCTTCCTGAGTGTCATCAACC; 65 °C; RFLP; TaqI.
6. GNB3; rs5443; CATCATCTGCGGCATCACG, ACGCTCAGACTTCATGGAGT; 60 °C; HRM; /.
7. SLC6A4; VNTR; GGGCAATGTCTGGCGCTTCCCCTACATA, TTCTGGCCTCTCAAGAGGACCTACAGC; 65,5 °C; PCR; /.
Statistical analysis The data was analyzed using IBM SPSS Statistics program package (IMB Inc., Armonk, New York). P ≤ 0.05 was considered as statistically significant.
The comparison of the share of traumatized and abused adolescents in the clinical sample and in the original control group has been done with the Fisher's exact test. All continuous variables were first assessed for the normality using Kolmogorov-Smirnov test of normality. Correlation between the age at the onset of NSSI and the total number of NSSI in life was determined using Spearman's correlation. The relationship between the total number of self-injuries (NSSI) in life and the value on the SICQ questionnaire has also been assessed using Spearman's correlation analysis. Relationship of the value of the SICQ questionnaire and the time that passes from the thought of NSSI to NSSI and also genotype and the total number of NSSI in life both have been assessed using Kruskal-Wallis H-test. The Mann-Whitney U-test had been used to determine the relationship between genotype and the age at the onset of NSSI. Different logistic regression models with parameters of the ETISR-SF questionnaire / BIS-11 / MSI - BPD / STAI STETE / STAI TRAIT and the candidate genotypes as independent variables and NSSI as dependent variable have been made. Unadjusted analyses of the rs1799971 / rs1800497 genotype itself and craving variable were carried out using Mann-Whitney U-test. The contribution of the rs1799971 / rs1800497 genotype to the level of craving for NSSI (SICQ) was studied using generalized linear models and was adjusted to STAI STATE and STAI TRAIT / ETISR - SF. Logistic regression models with candidate genotypes as independent variables and pain perception during NSSI as dependent variable have been made. The contribution of the rs1799971 / rs1800497 genotype to pain perception has been studied using logistic regression models that were adjusted to STAI STATE / STAI TRAIT / MSI - BPD/ ETISR - SF. The relationship between pain perception during NSSI and craving (SICQ) was assessed using Mann-Whitney U-test.
Aim of the study and the hypotheses The aim of the research was to carry out the first G x E study on the etiology of NSSI, diagnosed with the proposed research criteria from DSM-5, in Slovene adolescents. The investigators wanted to make the first association study of the rs1799971 in adolescents with NSSI and study the connection of the OPRM1 gene with addictive properties of NSSI and craving for NSSI. The goal was also to replicate the results of Joyce and his colleges (association of rs5443 and NSSI in depressive patients) in a sample of adolescents with NSSI.
The investigators have hypothesized that NSSI could be associated with one of the candidate polymorphisms or a combination of candidate polymorphisms. Further the investigators have hypothesized that the genetic polymorphisms associated to NSSI are the most connected to NSSI in traumatised individuals and that NSSI is associated with higher impulsivity.
Recruitment & Eligibility
- Status
- COMPLETED
- Sex
- All
- Target Recruitment
- 234
- absence of NSSI behavior over a lifetime,
- no treatment by a psychologist or a (child and adolescent) psychiatrist ever in life,
- age between 12 and 21 years.
- a diagnosis of mental disorder,
- intellectual disability,
- autism spectrum disorder.
General control group
Inclusion Criteria:
- age between 18 and 24 years.
Study & Design
- Study Type
- OBSERVATIONAL
- Study Design
- Not specified
- Arm && Interventions
Group Intervention Description clinical sample DNA extraction and genotyping of candidate genetic polymorphisms adolescents with nonsuicidal self-injury original control group DNA extraction and genotyping of candidate genetic polymorphisms adolescents with no history of nonsuicidal self-injury general control group DNA extraction and genotyping of candidate genetic polymorphisms adolescents from the general population original control group self-assessment questionnaires adolescents with no history of nonsuicidal self-injury clinical sample self-assessment questionnaires adolescents with nonsuicidal self-injury
- Primary Outcome Measures
Name Time Method Measurement of the craving for NSSI (with the Self-Injury Craving Questionnaire score) for the participants in the clinical sample. All of the included parameters are a one time measure. Calculation of the average craving for NSSI in the clinical sample has been made. Comparison of the average craving for NSSI in the clinical sample with the average cocaine craving score from the reference article has been made.
A logistic regression with the overall Early Trauma Inventory Self Report-Short Form (ETISR-SF) score, as well as rs1800497 polymorphism status as independent variables and the presence of NSSI as a dependent variable. All of the included parameters are a one time measure. The presence of NSSI has been determined with the group status (clinical sample or control group) of the participant.
Two generalized linear models between the polymorphism rs1799971 of the OPRM1 gene, two types of anxiety as covariates and craving for NSSI as dependent variable. All of the included parameters are a one time measure. The two types of anxiety measured with State-Trait Anxiety Inventory for Adults (STAI), which measures "State anxiety" - i.e. the level of anxiety that the individual feels at a given event and "Trait anxiety" - long-term state of the individual. Craving measured with Self-Injury Craving Questionnaire (SICQ).
Analysis of the relationship between candidate genotypes and pain perception during NSSI. All of the included parameters are a one time measure. Logistic regression models with candidate genotypes as independent variables and pain perception during NSSI as dependent variable have been made. The contribution of the rs1799971 / rs1800497 genotype to pain perception has been studied using logistic regression models that were adjusted to STAI STATE / STAI TRAIT / MSI - BPD/ ETISR - SF.
A logistic regression with the overall Early Trauma Inventory Self Report-Short Form (ETISR-SF) score, as well as SLC6A4 VNTR status as independent variables and the presence of NSSI as a dependent variable. All of the included parameters are a one time measure. The presence of NSSI has been determined with the group status (clinical sample or control group) of the participant.
- Secondary Outcome Measures
Name Time Method Analysis of the relationship between craving for NSSI as measured by Self-Injury Craving Questionnaire score and the number of NSSI episodes during lifetime (measured with the Inventory of Statements about Self - Injury). All of the included parameters are a one time measure. Different logistic regression models with parameters of the ETISR-SF / BIS-11 / MSI - BPD / STAI STETE / STAI TRAIT and rs5443 (GNβ3 gene) as independent variable and NSSI as dependent variable have been made. All of the included parameters are a one time measure. Analysis of the relationship between rs4537731 polymorphism status of the TPH 1 gene and age at the beginning of NSSI. All of the included parameters are a one time measure. Age at the beginning of NSSI has been measured with the Inventory of Statements about Self - Injury. In statistical analysis the Mann - Whitney U-test has been used.